DNA Transcription: From Gene to Protein

The Central Dogma

The central dogma of molecular biology describes the flow of genetic information: DNA → mRNA → Protein

Transcription converts a DNA sequence into messenger RNA (mRNA). Each thymine (T) in the DNA becomes uracil (U) in the RNA, while the other bases pair normally.

Translation reads the mRNA three nucleotides at a time. Each triplet — called a codon — maps to a specific amino acid. The chain of amino acids folds into a functional protein.

Let’s start by transcribing a DNA sequence into mRNA:

let dna = "ATGGCTAGCAAAGACTTCACC"
let mrna = Seq.transcribe(dna)
print("DNA:  " + dna)
print("mRNA: " + mrna)

Now translate that DNA sequence all the way to a protein chain:

let dna = "ATGGCTAGCAAAGACTTCACCGAGTACCTGCAGAACCTGATCGGCAAAGCCTTCGACTTTAAACAGATCGAAAACGCCCTGGAATGA"
let protein = Seq.translate(dna)
print("Protein: " + protein)

Exercise: Reverse Complement

Every DNA strand has a complementary strand running in the opposite direction. The reverse complement swaps each base with its pair (A↔T, C↔G) and reverses the result.

Write code to compute the reverse complement of the sequence below:

let dna = "ATGGCTAGCAAAGACTTCACC"
let rc = Seq.reverse_complement(dna)
print(rc)

GC Content Analysis

The GC content of a DNA sequence — the percentage of bases that are guanine (G) or cytosine (C) — affects the thermal stability of the double helix. Higher GC content means a higher melting temperature because G-C base pairs form three hydrogen bonds compared to two for A-T pairs.

let dna = "ATGGCTAGCAAAGACTTCACCGAGTACCTGCAG"
let gc = Seq.gc_content(dna)
print("GC content: " + gc)

Knowledge Check

Summary

In this unit you learned:

• How DNA is transcribed to mRNA (T → U substitution)
• How mRNA codons are translated to amino acids
• How to compute reverse complements
• How GC content relates to DNA stability