The Cytoskeleton

Introduction

Every eukaryotic cell faces a set of mechanical problems: it must maintain its shape, reorganize its interior, move materials from one place to another, and — when the time comes — physically divide in two. The cytoskeleton is the system of protein filaments that solves all of these problems. Far from a rigid scaffold, the cytoskeleton is a dynamic, self-organizing network that can assemble in seconds, disassemble just as quickly, and generate the forces that drive cell movement, intracellular transport, and chromosome segregation.

Three principal filament systems make up the eukaryotic cytoskeleton: actin filaments (microfilaments), microtubules, and intermediate filaments. Each is assembled from a different protein subunit, has a distinct diameter and mechanical properties, and performs specialized functions. Layered on top of these filaments are dozens of accessory proteins — motors, crosslinkers, cappers, and nucleators — that regulate filament behavior and harness it for cellular work. A fourth filament system, the septins, plays important roles in cell division and compartmentalization.

This lesson covers the structure, dynamics, and function of each filament system, the motor proteins that move along them, and the bioinformatics approaches used to classify and model cytoskeletal components.

16.1 — Function and Origin of the Cytoskeleton

The cytoskeleton is a defining feature of eukaryotic cells. Prokaryotes possess structural homologs of all three filament types — FtsZ (tubulin-like), MreB (actin-like), and crescentin (intermediate-filament-like) — but the eukaryotic cytoskeleton is vastly more elaborate, reflecting the larger cell volumes and complex internal organization that characterize eukaryotic life.

Cytoskeletal filaments adapt to provide different functions. The same basic building blocks are used in remarkably different contexts. Actin filaments, for example, form the stiff core of microvilli in intestinal epithelial cells, the dynamic leading edge of a migrating fibroblast, and the contractile ring that pinches a dividing cell in two. Microtubules build the mitotic spindle during division, the axonemal core of cilia and flagella, and the long tracks along which motor proteins ferry cargo through the cytoplasm of nerve cells. This versatility arises not from different filament types but from the accessory proteins that organize, stabilize, or remodel the same fundamental polymers in different ways.

The cytoskeleton can also form stable structures. While much emphasis is placed on cytoskeletal dynamics, many cytoskeletal assemblies are remarkably long-lived. The axonemes of cilia and flagella are stable microtubule arrays that persist for the life of the cell. The dense actin bundles in stereocilia of inner-ear hair cells are essentially permanent. Intermediate filament networks in epithelial cells and neurons provide mechanical resilience over timescales of days to years. The balance between dynamic and stable assemblies is tuned by accessory proteins and post-translational modifications.

16.2 — Actin and Actin-Binding Proteins

Actin is one of the most abundant and highly conserved proteins in eukaryotic cells. Humans express six actin isoforms: α-skeletal, α-cardiac, α-smooth, and γ-smooth actins are found primarily in muscle, while β-cytoplasmic and γ-cytoplasmic actins are ubiquitous. Despite being encoded by separate genes, these isoforms differ by only a handful of amino acids — a testament to intense purifying selection on actin sequence.

Filament Structure and Polarity

Actin subunits assemble head-to-tail to create flexible, polar filaments. Monomeric G-actin (globular actin) binds ATP and polymerizes into F-actin (filamentous actin), a two-stranded helical polymer approximately 7 nm in diameter. Because all subunits are oriented in the same direction, the filament has an inherent structural polarity: the two ends are chemically and kinetically distinct.

Nucleation Is Rate-Limiting

Nucleation is the rate-limiting step in the formation of actin filaments. Spontaneous nucleation — the assembly of the first few subunits into a stable seed — is thermodynamically unfavorable because small oligomers are unstable. Once a stable nucleus of three or more subunits forms, elongation proceeds readily. This kinetic barrier is important because it gives the cell control: by regulating where and when nucleation occurs, the cell determines the location and timing of new filament formation.

Plus-End and Minus-End Growth

Actin filaments have two distinct ends that grow at different rates. The fast-growing end is called the plus (barbed) end and the slow-growing end the minus (pointed) end. At physiological actin concentrations, monomers are added preferentially at the plus end. This asymmetric growth is central to cell motility: the plus end pushes outward against the plasma membrane at the leading edge.

ATP Hydrolysis and Treadmilling

ATP hydrolysis within actin filaments leads to treadmilling. Each G-actin monomer binds ATP before incorporation. Shortly after joining the filament, the subunit hydrolyzes its ATP to ADP + Pi, and Pi is slowly released. ADP-actin subunits are held less tightly in the filament and dissociate more readily from the minus end. At steady state, the rate of addition at the plus end equals the rate of loss at the minus end, and the filament appears to move through the cytoplasm — a phenomenon called treadmilling. The subunits themselves do not move; rather, they add at one end and leave at the other, creating a directional flux of monomers through the polymer.

Pharmacological Perturbation

The functions of actin filaments are inhibited by both polymer-stabilizing and polymer-destabilizing chemicals. Phalloidin (from the death cap mushroom Amanita phalloides) binds along the length of F-actin and prevents depolymerization. Cytochalasin D caps the plus end and blocks monomer addition. Latrunculin sequesters G-actin monomers, preventing polymerization. These drugs are invaluable research tools for dissecting actin-dependent processes. Jasplakinolide, a marine-sponge compound, stabilizes filaments similarly to phalloidin and is membrane-permeable, making it useful in live-cell experiments.

Actin-Binding Proteins

Actin-binding proteins influence filament dynamics and organization. The cell contains a large repertoire of actin-binding proteins (ABPs) that control every aspect of filament behavior:

Nucleating proteins accelerate actin-filament polymerization. The Arp2/3 complex is activated by WASP/WAVE family proteins and nucleates a new filament as a branch off an existing one, creating the dendritic network at the leading edge of migrating cells. Formins nucleate and remain processively associated with the growing plus end, producing the long, unbranched filaments found in filopodia, stress fibers, and the cytokinetic ring.

Cortex and Cell Architecture

Actin filaments form diverse structures in the cell cortex. Depending on the ABPs present, actin can be organized into:

• Lamellipodia — broad, sheet-like protrusions driven by Arp2/3-mediated branched networks
• Filopodia — thin, finger-like extensions stiffened by parallel bundles of actin cross-linked by fascin
• Stress fibers — contractile bundles of actin and myosin II anchored at focal adhesions
• Microvilli — finger-like projections on absorptive epithelia, supported by bundled actin cross-linked by villin and fimbrin
• Contractile ring — a transient belt of actin and myosin II that drives cytokinesis

A cortical network of actin filaments underlies the plasma membrane of most eukaryotic cells. This cell cortex — typically 100–200 nm thick — is a meshwork of short, branched actin filaments linked to the membrane through adaptor proteins such as ERM proteins (ezrin, radixin, moesin). The cortex determines cell shape, resists deformation, and generates the forces for cell division and migration.

Cell Crawling

Cell crawling depends on cortical actin. When a fibroblast or immune cell crawls across a surface, it follows a cycle of three steps: (1) protrusion at the leading edge, driven by actin polymerization pushing the membrane forward; (2) adhesion of the new protrusion to the substrate through integrin-based focal contacts; and (3) traction, in which myosin II–generated contraction pulls the rear of the cell forward. The leading edge is dominated by the Arp2/3-nucleated branched actin network, while stress fibers and myosin II provide the contractile force at the rear.

Self-Organization and External Signals

Actin-driven cell polarization can be a self-organizing process. In some systems, cells can polarize spontaneously — establishing a front and rear — without any external directional cue. Positive feedback loops (actin polymerization recruits more Arp2/3, which nucleates more actin) amplify small random fluctuations into a stable polarity axis.

External signals can activate the assembly and disassembly of actin structures. The Rho family GTPases — Rho, Rac, and Cdc42 — are master regulators of actin organization: Rho promotes stress fiber and focal adhesion formation, Rac drives lamellipodial extension, and Cdc42 triggers filopodia. These GTPases are activated by extracellular signals (growth factors, chemokines) through receptor-coupled guanine nucleotide exchange factors (GEFs) and inactivated by GTPase-activating proteins (GAPs).

Bioinformatics: Cytoskeletal Protein Classification

Actin is so highly conserved that sequence alignment can readily distinguish the six human isoforms and compare them across species. Databases such as the Cytoskeleton Database (CytoSkelDB) and the Actin DB catalog actin sequences, isoforms, and post-translational modifications across organisms. Structural analysis of actin-binding domains — such as the calponin homology (CH) domain found in filamin and α-actinin, or the WH2 domain used by WASP-family proteins — allows computational classification of new cytoskeletal proteins from genome sequences. Coarse-grained models of cytoskeletal dynamics use simplified representations of filaments and motors to simulate large-scale behaviors such as cortical flow and contractile ring constriction.

Let us compare how conserved actin is across species by aligning actin coding sequences from human, yeast, and Drosophila using multiple sequence alignment.

let human = "ATGGATGATGATATCGCCGCGCTCGTCGTCGACAAC"
let yeast = "ATGGATTCTGAGGTTGCTGCTTTGGTTATTGACAAT"
let fly = "ATGGATGATGACATTGCCGCTCTCGTCGTCGACAAC"
let msa = Seq.msa(human, yeast, fly)
print("Multi-species actin alignment (human, yeast, fly):")
print(msa)

Despite more than a billion years of divergence, human, yeast, and fly actin share substantial sequence identity — one of the most conserved proteins in all of eukaryotic biology. The multiple sequence alignment reveals conserved positions that are essential for actin polymerization and motor protein binding.

16.3 — Myosin and Actin

Actin-based motor proteins are members of the myosin superfamily. The human genome encodes roughly 40 myosin genes belonging to over a dozen classes. All myosins share a conserved motor (head) domain that binds actin and hydrolyzes ATP, but they differ in their tail domains, which determine cargo specificity and oligomerization.

Myosin generates force by coupling ATP hydrolysis to conformational changes. The power stroke model describes how the myosin head binds actin, undergoes a conformational change (the lever arm swing) that moves the filament, releases ADP, and detaches upon binding a new ATP. Each cycle moves the myosin head a defined distance — approximately 5–25 nm depending on the myosin class — along the actin filament.

Sliding of myosin II along actin filaments causes muscle contraction. In skeletal muscle, actin thin filaments and myosin II thick filaments are organized into repeating units called sarcomeres. When myosin heads ratchet along actin, the thin filaments slide inward, shortening the sarcomere. Coordinated contraction of millions of sarcomeres produces macroscopic muscle force. This sliding filament model, proposed by Huxley and Hanson in 1954, remains the foundation of our understanding of muscle contraction. Non-muscle myosin II operates by the same principle in stress fibers and the contractile ring.

16.4 — Microtubules

Structure and Polarity

Microtubules are hollow tubes with structurally distinct ends. They are built from α/β-tubulin heterodimers that assemble into linear protofilaments; 13 protofilaments associate laterally to form a hollow cylinder approximately 25 nm in diameter. Because all tubulin dimers are oriented the same way, the microtubule is polar: the plus end (where β-tubulin is exposed) grows faster, and the minus end (where α-tubulin is exposed) grows more slowly.

The Centrosome

The centrosome is the major microtubule-organizing center in animal cells. It consists of a pair of centrioles (cylindrical structures built from nine triplet microtubules) surrounded by pericentriolar material that contains the γ-tubulin ring complex (γ-TuRC). The γ-TuRC templates the minus end of new microtubules, anchoring them at the centrosome while the plus ends grow outward toward the cell periphery.

Dynamic Instability

Growing microtubules display dynamic instability. Individual microtubules alternate stochastically between phases of steady growth and rapid shrinkage (catastrophe). The transition from shrinkage back to growth is called rescue. This behavior means that a population of microtubules continually explores the cytoplasm, growing outward, collapsing, and regrowing in new directions — a search mechanism that is essential for finding and capturing kinetochores during mitosis.

Dynamic instability is driven by GTP hydrolysis in the tubulin subunit. Each β-tubulin binds GTP before incorporation. GTP-tubulin adds readily to the growing plus end, forming a stabilizing GTP cap. After polymerization, β-tubulin hydrolyzes GTP to GDP. GDP-tubulin has a curved conformation that destabilizes the lattice. As long as GTP-tubulin is added faster than hydrolysis proceeds, the GTP cap is maintained and the microtubule grows. If hydrolysis catches up to the tip, the GTP cap is lost, the protofilaments peel outward, and the microtubule rapidly depolymerizes (catastrophe).

Pharmacological Perturbation

Microtubule dynamics are modified by drugs. Taxol (paclitaxel), originally isolated from the Pacific yew tree, stabilizes microtubules and prevents depolymerization. Colchicine (from autumn crocus) binds tubulin dimers and prevents polymerization. Vinblastine and vincristine (from periwinkle) have similar effects. Both stabilizing and destabilizing drugs kill dividing cells by disrupting the mitotic spindle, making them valuable chemotherapy agents.

Microtubule-Organizing Centers and Nucleation

Microtubule-organizing centers nucleate microtubule growth. Beyond the centrosome, other MTOCs include the basal body (at the base of cilia and flagella, structurally identical to a centriole), the spindle pole body in yeast, and non-centrosomal MTOCs found in epithelial cells (where microtubules can be nucleated from the Golgi apparatus or the apical cortex). In all cases, γ-tubulin provides the template for new microtubule nucleation.

Microtubules emanate from the centrosome in animal cells, creating a radial array with plus ends at the periphery and minus ends anchored at the cell center. This organization establishes the directional highway along which motor proteins transport cargo.

Microtubule-Associated Proteins

Microtubule-binding proteins modulate filament dynamics and organization. Microtubule-associated proteins (MAPs) include:

• MAP2 and Tau — stabilize microtubules in neurons (Tau hyperphosphorylation and aggregation are hallmarks of Alzheimer disease)
• +TIPs (e.g., EB1, CLIP-170) — bind selectively to growing plus ends and regulate dynamic instability
• Stathmin/Op18 — sequesters tubulin dimers and promotes catastrophe
• Katanin — severs microtubules, releasing short fragments that can be transported or depolymerized

16.5 — Microtubule Motors and Microtubule-Associated Proteins

Motor Directionality

Dyneins move toward the minus end, while most kinesins move toward the plus end of a microtubule. The two major families of microtubule motors have opposite polarities:

Both kinesin and dynein use ATP-dependent conformational changes to “walk” along the microtubule lattice. Conventional kinesin (kinesin-1) is a processive motor, taking ~100 steps of 8 nm each before detaching. Cytoplasmic dynein requires the large accessory complex dynactin for processive movement and cargo attachment.

Intracellular Transport

Microtubule motor proteins drive intracellular transport. Organelles such as mitochondria, endoplasmic reticulum, endosomes, and secretory vesicles are actively transported along microtubule tracks. In neurons, this is particularly critical: the axon can be a meter or more in length, far too long for diffusion to deliver materials in a reasonable time. Anterograde transport (kinesin-driven, toward the synapse) delivers newly synthesized proteins and vesicles, while retrograde transport (dynein-driven, back to the cell body) returns signaling endosomes and recycled materials.

Motors and microtubule dynamics position organelles within cells. The Golgi apparatus, for example, is held near the centrosome by dynein-mediated minus-end-directed transport. If microtubules are depolymerized with nocodazole, the Golgi fragments and disperses. Endoplasmic reticulum tubules, by contrast, are extended toward the periphery by kinesins, and their shape depends on a balance between motor-driven extension and membrane curvature proteins.

Cilia and Flagella

Cilia and flagella contain stable microtubules moved by dynein. These structures are built on an axoneme — a highly ordered array of nine outer doublet microtubules surrounding a central pair (the 9+2 arrangement). Axonemal dynein motors, anchored on one doublet, walk along the adjacent doublet. Because the doublets are connected by nexin links and anchored at the basal body, this sliding is converted into bending, producing the characteristic beating motion.

Motile cilia (on airway epithelial cells, oviduct cells) beat in coordinated waves to move fluid across surfaces. Primary cilia (on most vertebrate cells) are non-motile sensory organelles that detect chemical and mechanical signals. Defects in ciliary assembly or function cause a class of diseases called ciliopathies, including primary ciliary dyskinesia, polycystic kidney disease, and Bardet-Biedl syndrome.

16.6 — The Mitotic Spindle

During cell division, the cytoskeleton reorganizes into the mitotic spindle — a bipolar microtubule-based machine that captures and segregates chromosomes with extraordinary precision.

Microtubule-dependent motor proteins govern spindle assembly and function. The spindle contains three classes of microtubules: astral microtubules (extend from poles toward the cortex, positioning the spindle within the cell), kinetochore microtubules (attach to chromosomes at the kinetochore and pull them toward the poles), and interpolar microtubules (overlap at the spindle midzone and are slid apart by plus-end-directed kinesins, pushing the poles apart).

Spindle assembly depends on the coordination of multiple motors:

• Kinesin-5 (Eg5) — a plus-end-directed motor that slides antiparallel interpolar microtubules apart, establishing spindle bipolarity
• Kinesin-14 (Ncd) — a minus-end-directed motor that opposes Eg5 and pulls poles together
• Cytoplasmic dynein — positioned at the cell cortex, pulls on astral microtubules to position the spindle and generate forces for anaphase B (spindle elongation)
• CENP-E (kinesin-7) — helps attach chromosomes to kinetochore fibers

The balance between these motors, combined with microtubule dynamic instability, allows the spindle to self-organize. Even in cell-free extracts, centrosomes and chromosomes can assemble a bipolar spindle — a remarkable example of molecular self-organization.

The progression of mitosis depends on the controlled destruction of cyclins. The transition from metaphase to anaphase is triggered by the anaphase-promoting complex/cyclosome (APC/C), a ubiquitin ligase that targets securin and cyclin B for destruction. Securin degradation releases separase, which cleaves the cohesin rings holding sister chromatids together. Cyclin B degradation inactivates Cdk1, allowing the cell to exit mitosis. The spindle assembly checkpoint (SAC) prevents APC/C activation until all chromosomes are correctly attached to the spindle, ensuring faithful chromosome segregation.

16.7 — Intermediate Filaments and Septins

Intermediate Filament Assembly

Intermediate filament structure depends on the lateral bundling and twisting of coiled coils. Unlike actin and tubulin, intermediate filament (IF) subunits do not bind nucleotides (no ATP or GTP). Instead, IF monomers contain a central α-helical rod domain flanked by variable head and tail domains. Two monomers wrap around each other to form a coiled-coil dimer. Two dimers associate in an antiparallel, staggered fashion to form a tetramer — this antiparallel arrangement eliminates polarity. Eight tetramers associate laterally to form a unit-length filament (ULF), and ULFs anneal end-to-end and compact to form the mature ~10 nm filament.

Mechanical Resilience

Intermediate filaments impart mechanical stability to animal cells. IFs are the most resistant cytoskeletal filaments to tensile stress. They can be stretched to several times their resting length before breaking — a property arising from the unfolding of their coiled-coil domains under tension.

Major IF types include:

Mutations in keratin genes cause epidermolysis bullosa simplex, a blistering skin disease in which basal epidermal cells rupture under mild mechanical stress — demonstrating the critical mechanical role of keratin IFs.

Nuclear Lamins and Linker Proteins

Linker proteins connect cytoskeletal filaments and bridge the nuclear envelope. The LINC complex (Linker of Nucleoskeleton and Cytoskeleton) spans the nuclear envelope, connecting nuclear lamins on the inside to cytoplasmic actin, microtubules, and intermediate filaments on the outside through SUN and nesprin proteins. This mechanical continuity allows forces applied to the cell surface to be transmitted to the nucleus, influencing nuclear shape, gene expression, and mechanotransduction.

Lamins form a meshwork beneath the inner nuclear membrane that provides structural support to the nucleus and helps organize chromatin. Mutations in LMNA (encoding lamins A and C) cause a spectrum of diseases collectively called laminopathies, including Emery-Dreifuss muscular dystrophy, dilated cardiomyopathy, familial partial lipodystrophy, and Hutchinson-Gilford progeria syndrome (premature aging). In progeria, a mutant lamin A called progerin distorts nuclear shape and disrupts heterochromatin organization, leading to accelerated cellular senescence.

Septins

Septins form filaments that are important for cell division. Septins are GTP-binding proteins that assemble into non-polar heterohexameric or heterooctameric complexes. These complexes polymerize end-to-end into filaments and associate laterally into higher-order rings and gauzes. In dividing cells, septins localize to the cleavage furrow, where they recruit and organize the cytokinetic machinery. Septins also act as diffusion barriers in the plasma membrane, helping to compartmentalize cell-surface domains — for example, they confine membrane proteins to the mother or bud in budding yeast.

Bioinformatics: Cytoskeleton Modeling and Image Analysis

Computational approaches are essential for understanding cytoskeletal systems, which involve thousands of interacting filaments and motors.

Agent-based and continuum models of cytoskeletal dynamics simulate the behavior of individual filaments and motors (agent-based) or describe the cytoskeleton as a continuous active gel (continuum). The Cytosim software is a widely used agent-based simulator that models filament nucleation, growth, catastrophe, and motor-driven sliding in configurable geometries. These models have been instrumental in understanding mitotic spindle self-organization, cortical flow, and contractile ring constriction.

Microtubule and actin filament tracking in microscopy images uses automated image analysis to extract quantitative measurements of filament dynamics from time-lapse fluorescence microscopy. CellProfiler and FIJI/ImageJ are open-source platforms with modules for filament detection, tracking, and measurement. Specialized tools like u-track and plusTipTracker track individual microtubule plus ends to measure growth rates, catastrophe frequencies, and rescue rates.

Molecular dynamics of motor proteins uses all-atom or coarse-grained simulations to study the mechanochemical cycle of kinesins, dyneins, and myosins — how ATP binding, hydrolysis, and product release are coupled to conformational changes in the motor domain.

Kinesin and dynein family classification relies on phylogenetic analysis of the motor domain. The kinesin superfamily encompasses at least 14 families (kinesin-1 through kinesin-14), each with distinct functions. Dynein is divided into cytoplasmic and axonemal classes. Databases like the Kinesin Home Page and the CyMoBase (Cytoskeletal Motor protein database) provide curated classifications.

Intermediate filament protein classification and disease variant analysis uses sequence and structural databases to categorize IF proteins into types I–VI and to catalog disease-causing mutations. The Human Intermediate Filament Database (HIFDB) links IF gene variants to clinical phenotypes, enabling genotype-phenotype correlation in laminopathies, epidermolysis bullosa, and other IF-related diseases.

Let us compare tubulin sequences across species to illustrate how tubulin conservation enables the same drugs (colchicine, taxol) to work across organisms.

let human_tub = "ATGAGGGAAATCGTGCACATCCAGGCCGGCCAG"
let fly_tub = "ATGCGCGAAATCGTCCACATCCAGGCTGGTCAG"
let worm_tub = "ATGAGAGAAATTGTCCACATCCAAGCTGGCCAG"
let msa = Seq.msa(human_tub, fly_tub, worm_tub)
print("Beta-tubulin multi-species alignment (human, fly, worm):")
print(msa)
let dist = Seq.hamming(human_tub, fly_tub)
print("Human-Fly mutations: " + dist)

The near-identity of β-tubulin across animal phyla explains why microtubule-targeting drugs like taxol are effective across species. Even single amino acid changes in the drug-binding site can confer resistance, underscoring the tight structure-function constraints on tubulin.

Now let us examine motor protein domains. Kinesin and myosin, despite being unrelated in overall structure, both contain P-loop NTPase motor domains. We can compare their amino acid properties to understand their distinct functions.

let kinesin_neck = "AEIPNAETHIPNFVN"
let myosin_lever = "DAIANAKHFENVRRL"
print("Kinesin neck-linker domain:")
print(Struct.protein_props(kinesin_neck))
print("Myosin lever arm domain:")
print(Struct.protein_props(myosin_lever))

The distinct properties of kinesin and myosin motor domains reflect their independent evolutionary origins despite analogous functions — both hydrolyze ATP and move along cytoskeletal filaments, but they are structurally distinct superfamilies.

Exercises

Exercise: Multi-Species Actin Conservation

Actin is among the most conserved proteins in eukaryotes. Use multiple sequence alignment to compare actin coding sequences across three species and count the mutations:

let human = "ATGGATGATGATATCGCCGCGCTCGTCGTCGAC"
let yeast = "ATGGATTCTGAGGTTGCTGCTTTGGTTATTGAC"
let fly = "ATGGATGATGACATTGCCGCTCTCGTCGTCGAC"
let msa = Seq.msa(human, yeast, fly)
print("Actin alignment (human, yeast, fly):")
print(msa)
let hf_dist = Seq.hamming(human, fly)
print("Human-Fly differences: " + hf_dist)
// Is actin conserved or diverged across eukaryotes?
let answer = "conserved"
print(answer)

Exercise: Translate a Lamin A Coding Fragment and Detect a Progeria-Related Region

Lamin A is encoded by the LMNA gene. Translate this fragment and the progeria variant, which carries a silent mutation that activates a cryptic splice site in the actual disease (here simplified as a coding change).

let lmna_normal = "ATGGAGACCCCGTCCCAGCGG"
let lmna_progeria = "ATGGAGACCCCGAGCCAGCGG"
let prot_normal = Seq.translate(lmna_normal)
let prot_progeria = Seq.translate(lmna_progeria)
print("Normal lamin A: " + prot_normal)
print("Progerin:       " + prot_progeria)
let answer = "Different"
print(answer)

Exercise: Compare Motor Protein Properties

Kinesin and myosin are both cytoskeletal motors but walk on different filaments. Analyze their motor domain properties to understand why kinesin is more processive:

let kinesin = "AEIPNAETHIPNFVNKILTEI"
let myosin = "DAIANAKHFENVRRLQEEFDK"
print("Kinesin motor domain:")
print(Struct.protein_props(kinesin))
print("Myosin motor domain:")
print(Struct.protein_props(myosin))
// Which motor is known for processivity (walking without detaching)?
let answer = "kinesin"
print(answer)

Knowledge Check

Summary

In this lesson you covered the structure, dynamics, and function of the eukaryotic cytoskeleton:

• Three filament systems — actin filaments (~7 nm), microtubules (~25 nm), and intermediate filaments (~10 nm) — provide shape, transport, and mechanical strength
• Actin filaments are polar, ATP-driven polymers that undergo treadmilling; the Arp2/3 complex and formins nucleate branched and unbranched networks, respectively
• Rho GTPases (Rho, Rac, Cdc42) relay extracellular signals to control actin organization in lamellipodia, filopodia, and stress fibers
• Cell crawling follows a cycle of protrusion (actin polymerization), adhesion (integrins), and traction (myosin II contraction)
• Myosin superfamily motors move along actin; myosin II drives muscle contraction via the sliding filament mechanism in sarcomeres
• Microtubules are GTP-driven hollow tubes that exhibit dynamic instability — stochastic switching between growth and catastrophe controlled by the GTP cap
• The centrosome organizes a radial microtubule array via γ-tubulin ring complexes; other MTOCs include basal bodies and Golgi-associated sites
• Kinesins (mostly plus-end-directed) and cytoplasmic dynein (minus-end-directed) drive intracellular transport along microtubules
• Cilia and flagella use axonemal dynein to bend a stable 9+2 microtubule axoneme; defects cause ciliopathies
• The mitotic spindle self-organizes through the interplay of kinesin-5, kinesin-14, and dynein; the APC/C triggers anaphase by destroying securin and cyclin B
• Intermediate filaments are nonpolar, mechanically tough polymers built from antiparallel coiled-coil tetramers; mutations in keratins and lamins cause tissue fragility and laminopathies
• Septins are GTP-binding filaments that organize the cytokinetic ring and act as membrane diffusion barriers
• Taxol and colchicine target microtubules; phalloidin and latrunculin target actin — all are critical research and clinical tools
• Bioinformatics tools (CyMoBase, CellProfiler, Cytosim, HIFDB) support motor protein classification, filament tracking, cytoskeletal simulation, and disease variant analysis